Hi,
I used Delly for the detection of SVs in a cohort of WGS horses data, 24 samples totally.
In the results we have a number of translocations and we cannot understand how it can be interpreted.
For example, we have this translocation:
ChrX 144593 BND00085733 G ]Chr31:58386]G 1357 PASS CIEND=-53,53;CIPOS=-53,53;CHR2=Chr31;POS2=58386;END=144594;PE=53;MAPQ=23;CT=5to3;IMPRECISE;SVTYPE=BND;SVMETHOD=EMBL.DELLYv1.1.6 GT:GL:GQ:FT:RC:RCL:RCR:RDCN:DR:DV:RR:RV 0/0:0,-5.70365,-92.7841:57:PASS:33196:10931:22265:2:19:0:0:0 0/0:0,-1.70861,-25.3024:17:PASS:7555:2282:5273:2:6:0:0:0 0/0:0,-4.81518,-73.9987:48:PASS:19184:6147:13037:2:16:0:0:0 0/0:0,-6.30303,-107.581:63:PASS:21609:6490:15119:2:21:0:0:0 0/1:-47.2571,0,-334.732:10000:PASS:71153:17317:53836:2:76:73:0:0 0/1:-55.6442,0,-141.843:10000:PASS:62019:13961:48058:2:38:68:0:0
I see, that it's translocation Chr31--> ChrX. But how long is it? For me it looks like 1 only nucleotide (start is ChrX:144593, END=144594).
But we have a big deletion in the same region (ChrX:133262-674011), which is in ChrX in our samples, but the part of that region (a few genes) is annotated as Chr31 in reference genome:
ChrX 133262 DEL00085723 A <DEL> 224 PASS CIEND=-21,21;CIPOS=-21,21;END=674011;PE=5;MAPQ=8;SRMAPQ=60;SR=4;SRQ=0.967532;CONSENSUS=CGAGGGATGAGAGATAGATGGACAAATGGACAGACAGATAGGTAGACGGATAGATAGATAGAAGGATGGATGGATGGATGGATGGATGGATAGATGGATGGATGGATGGATGGATGGACGGACGGACGGACGGACGGACGGATGGATAGATGGA;CE=1.75053;CT=3to5;PRECISE;SVTYPE=DEL;SVMETHOD=EMBL.DELLYv1.1.6;INSLEN=0;HOMLEN=30 GT:GL:GQ:FT:RC:RCL:RCR:RDCN:DR:DV:RR:RV 0/1:-3.03989,0,-6.33169:30:PASS:24646:15610:16262:2:6:0:5:3 0/1:-1.41671,0,-2.39909:14:LowQual:5441:3133:3015:2:1:0:2:1 0/1:-7.28711,0,-2.50107:25:PASS:13433:8461:8079:2:4:0:3:4
So, as I understand, that it can be only if the translocation BND00085733 is covered the big region of these deletion.
And it's again the question about the length of the translocation.
And next, we have a lot of translocations in close regions, for example for the start of ChrX:
BND00085692 | X:93540-93541
BND00085704 | X:120908-120909
BND00085706 | X:122500-122501
BND00085707 | X:122505-122506
BND00085733 | X:144593-144594
BND00085734 | X:145427-145428
BND00085797 | X:248440-248441
BND00085830 | X:318302-318303
BND00085852 | X:336452-336453
BND00085872 | X:357454-357455
BND00085873 | X:357557-357558
BND00085984 | X:556817-556818
BND00085990 | X:581332-581333
BND00085991 | X:581339-581340
BND00086005 | X:616339-616340
BND00086011 | X:618043-618044
BND00086013 | X:624038-624039
BND00086023 | X:628668-628669
BND00086030 | X:634119-634120
BND00086041 | X:674280-674281
BND00086130 | X:789815-789816
BND00086152 | X:821768-821769
BND00086153 | X:821774-821775
BND00086183 | X:890141-890142
BND00086234 | X:1024169-1024170
BND00086235 | X:1024173-1024174
BND00086251 | X:1081262-1081263
BND00086255 | X:1109382-1109383
BND00086279 | X:1359952-1359953
BND00086280 | X:1359954-1359955
BND00086413 | X:1475928-1475929
For me it looks like it's 1 nucleotide only translocations (?)
Do I need to filter out these translocations in some way or are all of them actual?
Thank you for the help!
Hi,
I used Delly for the detection of SVs in a cohort of WGS horses data, 24 samples totally.
In the results we have a number of translocations and we cannot understand how it can be interpreted.
For example, we have this translocation:
ChrX 144593 BND00085733 G ]Chr31:58386]G 1357 PASS CIEND=-53,53;CIPOS=-53,53;CHR2=Chr31;POS2=58386;END=144594;PE=53;MAPQ=23;CT=5to3;IMPRECISE;SVTYPE=BND;SVMETHOD=EMBL.DELLYv1.1.6 GT:GL:GQ:FT:RC:RCL:RCR:RDCN:DR:DV:RR:RV 0/0:0,-5.70365,-92.7841:57:PASS:33196:10931:22265:2:19:0:0:0 0/0:0,-1.70861,-25.3024:17:PASS:7555:2282:5273:2:6:0:0:0 0/0:0,-4.81518,-73.9987:48:PASS:19184:6147:13037:2:16:0:0:0 0/0:0,-6.30303,-107.581:63:PASS:21609:6490:15119:2:21:0:0:0 0/1:-47.2571,0,-334.732:10000:PASS:71153:17317:53836:2:76:73:0:0 0/1:-55.6442,0,-141.843:10000:PASS:62019:13961:48058:2:38:68:0:0I see, that it's translocation Chr31--> ChrX. But how long is it? For me it looks like 1 only nucleotide (start is
ChrX:144593,END=144594).But we have a big deletion in the same region (
ChrX:133262-674011), which is in ChrX in our samples, but the part of that region (a few genes) is annotated asChr31in reference genome:ChrX 133262 DEL00085723 A <DEL> 224 PASS CIEND=-21,21;CIPOS=-21,21;END=674011;PE=5;MAPQ=8;SRMAPQ=60;SR=4;SRQ=0.967532;CONSENSUS=CGAGGGATGAGAGATAGATGGACAAATGGACAGACAGATAGGTAGACGGATAGATAGATAGAAGGATGGATGGATGGATGGATGGATGGATAGATGGATGGATGGATGGATGGATGGACGGACGGACGGACGGACGGACGGATGGATAGATGGA;CE=1.75053;CT=3to5;PRECISE;SVTYPE=DEL;SVMETHOD=EMBL.DELLYv1.1.6;INSLEN=0;HOMLEN=30 GT:GL:GQ:FT:RC:RCL:RCR:RDCN:DR:DV:RR:RV 0/1:-3.03989,0,-6.33169:30:PASS:24646:15610:16262:2:6:0:5:3 0/1:-1.41671,0,-2.39909:14:LowQual:5441:3133:3015:2:1:0:2:1 0/1:-7.28711,0,-2.50107:25:PASS:13433:8461:8079:2:4:0:3:4So, as I understand, that it can be only if the translocation
BND00085733is covered the big region of these deletion.And it's again the question about the length of the translocation.
And next, we have a lot of translocations in close regions, for example for the start of ChrX:
For me it looks like it's 1 nucleotide only translocations (?)
Do I need to filter out these translocations in some way or are all of them actual?
Thank you for the help!